| Question | Answer | % Correct |
|---|---|---|
| Which of the following statements about unicellular and multicellular organisms is incorrect? | Prokaryotic cells are unicellular while eukaryotic cells are multicellular. | 55%
|
| During DNA replication, several enzymes play crucial roles in ensuring the accurate duplication of genetic material. Which of the following statements correctly describes the enzymes involved in the DNA replication process? | Helicase unwinds the DNA double helix, while DNA polymerase synthesizes new DNA strands by adding nucleotides complementary to the template strand. | 50%
|
| Which of the following statements accurately distinguishes prokaryotic cells from eukaryotic cells based on their structural and genetic characteristics? | Eukaryotic cells can contain multiple linear chromosomes, while prokaryotic cells typically have a single circular chromosome. | 45%
|
| A team of scientists discovers a novel entity in a deep-sea hydrothermal vent. It exhibits unique features that have left the scientists perplexed as to whether to classify it as an organism. Which of the following statements would be true if proven? | If the entity demonstrates self-replication and metabolic activity, it would support the classification as a living organism. | 45%
|
| Which of the following statements accurately distinguishes between somatic cells and germ cells? | Somatic cells undergo mitosis for growth and repair, while germ cells undergo meiosis to produce gametes, resulting in genetic diversity. | 45%
|
| A population of flowering plants has developed a mutation that affects petal color. The mutation leads to vibrant red petals instead of the typical yellow. Researchers observe the following outcomes: • Pollinators, particularly hummingbirds, are more attracted to the red flowers, resulting in increased pollination rates and higher seed production. • The red petals make the flowers more visible to herbivores, leading to increased damage to the plants in some areas. • The plants with red petals show no difference in drought tolerance compared to those with yellow petals Based on the information provided, which of the following statements most accurately describes the nature of the mutation? | The mutation is mostly beneficial because of overall increased pollination rates and seed production whereas the increase in damage is only in some areas. | 45%
|
| Mutagens are agents that can cause changes in the DNA sequence of an organism. They can be classified into several categories based on their origin and mechanism of action. Which of the following statements about mutagens is true? | Biological mutagens, such as certain viruses, can integrate their genetic material into the host DNA, potentially leading to mutations. | 40%
|
| Which of the following statements is correct regarding the processes of mitosis? | During prophase, chromatin condenses into chromosomes, which consist of two sister chromatids joined at the centromere. | 40%
|
| Which of the following statements correctly describes the roles and characteristics of microtubules, intermediate filaments, and microfilaments in the cytoskeleton? | Microtubules facilitate intracellular transport and cell division, while microfilaments are involved in muscle contraction and cell movement. | 40%
|
| In an experiment, a reaction occurs when organic compounds are burned, resulting in the release of a gas. The characteristics of the gas are as follows: • It is colorless and has a slightly sour taste. • It does not support combustion and can extinguish flames Based on this data, what gas do you predict was released during the reaction? | Carbon dioxide | 35%
|
| Which of the following statements about genetic editing technologies is incorrect? | Genetic editing is a promising technique for the treatment of genetic disorders, but it is unlikely to be available in clinical settings in the near future. | 35%
|
| Which one of the following best describes the role of hydrogen bonds in DNA structure. | Hydrogen bonds are relatively weak bonds that stabilize the double helix by forming base pairs between complementary nucleotides. | 35%
|
| Sickle cell anemia is a genetic disorder caused by a mutation in the hemoglobin gene. Which of the following statements about sickle cell anemia is true? | Individuals with sickle cell anemia have red blood cells that can assume a rigid, crescent shape under low oxygen conditions, leading to blockages in blood vessels. | 35%
|
| Which of the following events occurs during the transition from the Gl phase to the S phase of the cell cycle? | The cell assesses DNA integrity and prepares for DNA replication. | 35%
|
| Which of the following statements correctly describes cell checkpoints in the cell cycle? | The G2 checkpoint verifies that DNA replication has been completed accurately and assesses for DNA damage before the cell enters mitosis. | 35%
|
| A scientist is studying a specific mutation in a gene that encodes a protein involved in cell signalling. This mutation results in a single amino acid substitution in the protein. Which of the following statements best describes the potential impact of this mutation on the protein's function? | The mutation may alter the protein's function depending on the substituted amino acid. | 35%
|
| Which of the following statements correctly describes a type of mutation? | Translocation occurs when a segment of DNA from one chromosome is transferred to a different chromosome. | 35%
|
| The discovery of base pairing was a fundamental aspect of understanding the structure of DNA. Which of the following statements accurately reflects the contributions to this discovery? | Erwin Chargaff's research established that the amounts of A and T are always equal, as well as the amounts of C and G, leading to the identification of base pairing. | 25%
|
| Why did scientists study proteins before DNA in the context of heredity and cellular functions? | Proteins were visible traits and more accessible for observation, allowing scientists to easily correlate them with phenotypic characteristics. | 25%
|
| Which of the following statements about the components of eukaryotic cells is incorrect? | The cell wall regulates the movement of substances in and out of the cell, functioning like a protective membrane. | 25%
|
| Which of the following statements about the Human Genome Project (HGP) is incorrect? | The HGP successfully mapped and sequenced all human proteins. | 25%
|
| A 55-year-old patient presents with a mass in the breast. A biopsy is performed to test the cellular contents of the mass. Which of the following statements would most strongly suggests that the mass may be cancerous? | The cells in the mass demonstrate a slow growth rate but are capable of dividing in the absence of growth factors. | 20%
|
| Which of the following best distinguishes the functions of the rough ER, smooth ER, and ribosomes within a eukaryotic cell? | The rough ER is involved in the synthesis of proteins, while the smooth ER is important for lipid synthesis. | 20%
|
| A patient is diagnosed with a type of cancer characterized by uncontrolled cell proliferation. Genetic testing revealed confusing results as multiple mutations in genes involved in the cell cycle and cell proliferation were uncovered. Based on this information, what type of gene is likely to be the cause of the cancer? | A DNA repair gene | 15%
|
| Which of the following statements best reflects a key concept of cell theory and its historical context? | The discovery of cells was facilitated by the invention of the microscope in the 17th century. | 15%
|
| Given the genetic sequence TCAGGAATGTCTACTAGCGCGCTGTAAAAT, what is the sequence of amino acids that would be translated? (Note: In order to add the photo I had to put it as an option, It is NOT the right answer) | Methionine - Serine - Threonine - Serine - Alanine - Arginine - Leucine | 10%
|